keyword in microRNA or target gene :
The pre-miRNA of MI0000459
Gene
HGNC MIRN143
Accession no
MI0000459
ID
hsa-mir-143
Species
Homo sapiens
Description
Homo sapiens miR-143 stem-loop
Genomic Location
5 : 148788674 - 148788779 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
106 nt
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-143 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-143 hsa-mir-143 rno-mir-143 dre-mir-143-1 dre-mir-143-2
ptr-mir-143 ggo-mir-143 ppy-mir-143 lla-mir-143 ppa-mir-143
xtr-mir-143 mdo-mir-143
The mature miRNA of MI0000459
Mature name
hsa-miR-143
Mature sequence
61| 5'- UGAGAUGAAGCACUGUAGCUCA -3' |82
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377083 (targeted by hsa-miR-143, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000240185 (targeted by hsa-miR-143, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
ENST00000375753 (targeted by hsa-miR-143, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 459482 0937119471