keyword in microRNA or target gene :
The pre-miRNA of MI0000458
Gene
HGNC MIRN142
Accession no
MI0000458
ID
hsa-mir-142
Species
Homo sapiens
Description
Homo sapiens miR-142 stem-loop
Genomic Location
17 : 53763592 - 53763678 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
87 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Michael et al. verified the expression of a sequence from the 3' arm of this stem-loop (named miR-142-3p here) [2], and both miR-142-5p (from the 5' arm) and miR-142-3p ware later detected in human HL-60 leukemia cells [3].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-142 hsa-mir-142 rno-mir-142 gga-mir-142 dre-mir-142a
dre-mir-142b fru-mir-142a tni-mir-142a fru-mir-142b tni-mir-142b
xtr-mir-142-1 xtr-mir-142-2 bta-mir-142 mdo-mir-142
The mature miRNA of MI0000458
Mature name
hsa-miR-142-5p
Mature sequence
16| 5'- CAUAAAGUAGAAAGCACUAC -3' |35
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000375499 (targeted by hsa-miR-142-5p, predicted by TargetScan)
Succinate dehydrogenase [ubiquinone] iron-sulfur protein, mitochondrial precursor (EC 1.3.5.1) (Ip) (Iron-sulfur subunit of complex II). [Source:Uniprot/SWISSPROT;Acc:P21912]
 
     
ENST00000371544 (targeted by hsa-miR-142-5p, predicted by TargetScan)
Zinc finger CCHC domain-containing protein 11. [Source:Uniprot/SWISSPROT;Acc:Q5TAX3]
 
     
ENST00000257177 (targeted by hsa-miR-142-5p, predicted by TargetScan)
Zinc finger CCHC domain-containing protein 11. [Source:Uniprot/SWISSPROT;Acc:Q5TAX3]
 
     
   
 
The mature miRNA of MI0000458
Mature name
hsa-miR-142-3p
Mature sequence
52| 5'- UGUAGUGUUUCCUACUUUAUGGA -3' |74
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378609 (targeted by hsa-miR-142-3p, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378606 (targeted by hsa-miR-142-3p, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000240185 (targeted by hsa-miR-142-3p, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
3. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 965567 0937119471