keyword in microRNA or target gene :
The pre-miRNA of MI0000457
Gene
HGNC MIRN141
Accession no
MI0000457
ID
hsa-mir-141
Species
Homo sapiens
Description
Homo sapiens miR-141 stem-loop
Genomic Location
12 : 6943521 - 6943615 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
95 nt
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-141 in human [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-8 mmu-mir-141 mmu-mir-200b hsa-mir-200b hsa-mir-141
mmu-mir-200a hsa-mir-200c mmu-mir-200c hsa-mir-200a rno-mir-141
rno-mir-200c rno-mir-200a rno-mir-200b gga-mir-200a gga-mir-200b
dps-mir-8 xla-mir-429 ame-mir-8 aga-mir-8 hsa-mir-429
mmu-mir-429 rno-mir-429 cfa-mir-429 dre-mir-429 dre-mir-141
dre-mir-200a dre-mir-200b dre-mir-200c mml-mir-200c mml-mir-141
ggo-mir-200c ggo-mir-141 ppy-mir-200c ppy-mir-141 ppa-mir-141
fru-mir-429 tni-mir-429 fru-mir-200a tni-mir-200a fru-mir-200b
tni-mir-200b gga-mir-429 xtr-mir-200a xtr-mir-200b xtr-mir-429
bmo-mir-8 bta-mir-200a bta-mir-200c bta-mir-200b mdo-mir-200c
mdo-mir-141 mdo-mir-200b mdo-mir-200a
The mature miRNA of MI0000457
Mature name
hsa-miR-141
Mature sequence
59| 5'- UAACACUGUCUGGUAAAGAUGG -3' |80
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377083 (targeted by hsa-miR-141, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000375753 (targeted by hsa-miR-141, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000374937 (targeted by hsa-miR-141, predicted by TargetScan)
Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII). [Source:Uniprot/SWISSPROT;Acc:O43432]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 775906 0937119471