keyword in microRNA or target gene :
The pre-miRNA of MI0000456
Gene
HGNC MIRN140
Accession no
MI0000456
ID
hsa-mir-140
Species
Homo sapiens
Description
Homo sapiens miR-140 stem-loop
Genomic Location
16 : 68524485 - 68524584 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000356003 intron + 16
ENST00000359154 intron + 16
ENST00000379000 intron + 16
OTTHUMT00000268954 intron + 16
OTTHUMT00000156065 intron + 17
OTTHUMT00000156067 intron + 6
OTTHUMT00000156064 intron + 16
View the flanking features in the Genome Browser
Pre-miRNA length
100 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-140 hsa-mir-140 rno-mir-140 gga-mir-140 dre-mir-140
ssc-mir-140 ptr-mir-140 mne-mir-140 fru-mir-140 tni-mir-140
xtr-mir-140 bta-mir-140
The mature miRNA of MI0000456
Mature name
hsa-miR-140
Mature sequence
24| 5'- AGUGGUUUUACCCUAUGGUAG -3' |44
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000240185 (targeted by hsa-miR-140, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
ENST00000339726 (targeted by hsa-miR-140, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
ENST00000371750 (targeted by hsa-miR-140, predicted by TargetScan)
Uncharacterized protein C1orf34 (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q6PIU8]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 673381 0937119471