keyword in microRNA or target gene :
The pre-miRNA of MI0000454
Gene
HGNC MIRN137
Accession no
MI0000454
ID
hsa-mir-137
Species
Homo sapiens
Description
Homo sapiens miR-137 stem-loop
Genomic Location
1 : 98284214 - 98284315 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
102 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-137 hsa-mir-137 rno-mir-137 gga-mir-137 dre-mir-137-1
dre-mir-137-2 fru-mir-137 tni-mir-137 xtr-mir-137-1 xtr-mir-137-2
xtr-mir-137-3 mdo-mir-137 ame-mir-137
The mature miRNA of MI0000454
Mature name
hsa-miR-137
Mature sequence
60| 5'- UAUUGCUUAAGAAUACGCGUAG -3' |81
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000339726 (targeted by hsa-miR-137, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
ENST00000341115 (targeted by hsa-miR-137, predicted by TargetScan)
Mucolipin-3. [Source:Uniprot/SWISSPROT;Acc:Q8TDD5]
 
     
ENST00000370256 (targeted by hsa-miR-137, predicted by TargetScan)
Formin-binding protein 1-like (Transducer of Cdc42-dependent actin assembly protein 1) (Toca-1). [Source:Uniprot/SWISSPROT;Acc:Q5T0N5]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 715839 0937119471