keyword in microRNA or target gene :
The pre-miRNA of MI0000452
Gene
HGNC MIRN135A1
Accession no
MI0000452
ID
hsa-mir-135a-1
Species
Homo sapiens
Description
Homo sapiens miR-135a-1 stem-loop
Genomic Location
3 : 52303275 - 52303364 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
90 nt
Comments
miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-135a-1 hsa-mir-135a-1 hsa-mir-135a-2 rno-mir-135b mmu-mir-135b
mmu-mir-135a-2 hsa-mir-135b rno-mir-135a gga-mir-135a-2 gga-mir-135a-1
gga-mir-135a-3 dre-mir-135c-1 dre-mir-135c-2 dre-mir-135c-3 ssc-mir-135-1
ssc-mir-135-2 lla-mir-135-1 age-mir-135-1 ppa-mir-135-1 mml-mir-135
ptr-mir-135 ggo-mir-135 ppy-mir-135 lla-mir-135-2 age-mir-135-2
ppa-mir-135-2 fru-mir-135b tni-mir-135b dre-mir-135b fru-mir-135a
tni-mir-135a dre-mir-135a xtr-mir-135-1 xtr-mir-135-2 mdo-mir-135a
mdo-mir-135b
The mature miRNA of MI0000452
Mature name
hsa-miR-135a
Mature sequence
17| 5'- UAUGGCUUUUUAUUCCUAUGUGA -3' |39
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378609 (targeted by hsa-miR-135a, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378606 (targeted by hsa-miR-135a, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000377565 (targeted by hsa-miR-135a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 287122 0937119471