keyword in microRNA or target gene :
The pre-miRNA of MI0000450
Gene
HGNC MIRN133A1
Accession no
MI0000450
ID
hsa-mir-133a-1
Species
Homo sapiens
Description
Homo sapiens miR-133a-1 stem-loop
Genomic Location
18 : 17659657 - 17659744 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000261537 intron - 12
OTTHUMT00000147489 intron - 12
OTTHUMT00000147491 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
88 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-133a-1 dme-mir-133 hsa-mir-133a-1 hsa-mir-133a-2 mmu-mir-133a-2
mmu-mir-133b hsa-mir-133b rno-mir-133a gga-mir-133a-1 gga-mir-133b
gga-mir-133a-2 gga-mir-133c dps-mir-133 xla-mir-133a ame-mir-133
aga-mir-133 dre-mir-133a-2 dre-mir-133a-1 dre-mir-133b dre-mir-133c
ggo-mir-133a age-mir-133a ppa-mir-133a ppy-mir-133a ptr-mir-133a
mml-mir-133a sla-mir-133a lla-mir-133a mne-mir-133a fru-mir-133
tni-mir-133 rno-mir-133b xtr-mir-133c xtr-mir-133d xtr-mir-133b
xtr-mir-133a mdo-mir-133a
The mature miRNA of MI0000450
Mature name
hsa-miR-133a
Mature sequence
54| 5'- UUGGUCCCCUUCAACCAGCUGU -3' |75
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000376838 (targeted by hsa-miR-133a, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
ENST00000361445 (targeted by hsa-miR-133a, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
ENST00000361947 (targeted by hsa-miR-133a, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 228584 0937119471