keyword in microRNA or target gene :
The pre-miRNA of MI0000449
Gene
HGNC MIRN132
Accession no
MI0000449
ID
hsa-mir-132
Species
Homo sapiens
Description
Homo sapiens miR-132 stem-loop
Genomic Location
17 : 1899952 - 1900052 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
101 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-132 hsa-mir-212 hsa-mir-132 mmu-mir-212 rno-mir-132
rno-mir-212 dre-mir-132-1 dre-mir-132-2 fru-mir-212 tni-mir-212
dre-mir-212 fru-mir-132 tni-mir-132 xtr-mir-132 xtr-mir-212
bta-mir-132 mdo-mir-212 mdo-mir-132
The mature miRNA of MI0000449
Mature name
hsa-miR-132
Mature sequence
59| 5'- UAACAGUCUACAGCCAUGGUCG -3' |80
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377565 (targeted by hsa-miR-132, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000375729 (targeted by hsa-miR-132, predicted by TargetScan)
Zinc finger and BTB domain-containing protein 17 (Zinc finger protein 151) (Myc-interacting zinc finger protein) (Miz-1 protein). [Source:Uniprot/SWISSPROT;Acc:Q13105]
 
     
ENST00000361548 (targeted by hsa-miR-132, predicted by TargetScan)
Grainyhead-like protein 3 homolog (Sister of mammalian grainyhead) (Transcription factor CP2-like 4). [Source:Uniprot/SWISSPROT;Acc:Q8TE85]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 335218 0937119471