keyword in microRNA or target gene :
The pre-miRNA of MI0000448
Gene
HGNC MIRN130A
Accession no
MI0000448
ID
hsa-mir-130a
Species
Homo sapiens
Description
Homo sapiens miR-130a stem-loop
Genomic Location
11 : 57165247 - 57165335 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
89 nt
Comments
miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-130a mmu-mir-301 mmu-mir-130b hsa-mir-130a rno-mir-301
hsa-mir-301 hsa-mir-130b rno-mir-130a rno-mir-130b gga-mir-130b
gga-mir-301 gga-mir-130a dre-mir-130a-1 dre-mir-130a-2 dre-mir-130b
dre-mir-130c-1 dre-mir-130c-2 dre-mir-301a-1 dre-mir-301a-2 dre-mir-301b
dre-mir-301c ssc-mir-301 mml-mir-130a ggo-mir-130a mne-mir-130a
ppa-mir-130a fru-mir-301 tni-mir-301 fru-mir-130 tni-mir-130
mmu-mir-301b xtr-mir-130a xtr-mir-130c xtr-mir-130b xtr-mir-301-1
xtr-mir-301-2 mdo-mir-130a
The mature miRNA of MI0000448
Mature name
hsa-miR-130a
Mature sequence
55| 5'- CAGUGCAAUGUUAAAAGGGCAU -3' |76
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-130a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-130a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000240185 (targeted by hsa-miR-130a, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 894175 0937119471