keyword in microRNA or target gene :
The pre-miRNA of MI0000447
Gene
HGNC MIRN128A
Accession no
MI0000447
ID
hsa-mir-128a
Species
Homo sapiens
Description
Homo sapiens miR-128a stem-loop
Genomic Location
2 : 136139437 - 136139518 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000329971 intron + 15
ENST00000264160 intron + 18
View the flanking features in the Genome Browser
Pre-miRNA length
82 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later validated in human HL-60 leukemia cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-128a hsa-mir-128a mmu-mir-128b hsa-mir-128b rno-mir-128a
rno-mir-128b gga-mir-128-2 gga-mir-128-1 dre-mir-128-1 dre-mir-128-2
ssc-mir-128a mml-mir-128a ptr-mir-128a ppy-mir-128a sla-mir-128a
age-mir-128a ppa-mir-128a fru-mir-128-2 tni-mir-128-2 fru-mir-128-1
tni-mir-128-1 bta-mir-128a xtr-mir-128-2 xtr-mir-128-1 mdo-mir-128b
The mature miRNA of MI0000447
Mature name
hsa-miR-128a
Mature sequence
50| 5'- UCACAGUGAACCGGUCUCUUUU -3' |71
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-128a, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-128a, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-128a, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 7420 0937119471