keyword in microRNA or target gene :
The pre-miRNA of MI0000443
Gene
HGNC MIRN124A1
Accession no
MI0000443
ID
hsa-mir-124a-1
Species
Homo sapiens
Description
Homo sapiens miR-124a-1 stem-loop
Genomic Location
8 : 9798308 - 9798392 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
85 nt
Comments
miR-124a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-124a-3 cel-mir-124 dme-mir-124 hsa-mir-124a-1 hsa-mir-124a-2
hsa-mir-124a-3 cbr-mir-124 mmu-mir-124a-1 mmu-mir-124a-2 rno-mir-124a-3
rno-mir-124a-1 rno-mir-124a-2 gga-mir-124a gga-mir-124b-1 gga-mir-124b-2
dps-mir-124 ame-mir-124 aga-mir-124 dre-mir-124-1 dre-mir-124-2
dre-mir-124-3 dre-mir-124-4 dre-mir-124-5 dre-mir-124-6 ssc-mir-124a
ggo-mir-124a age-mir-124a ppa-mir-124a ppy-mir-124a ptr-mir-124a
mml-mir-124a lla-mir-124a fru-mir-124-3 tni-mir-124-3 fru-mir-124-1
tni-mir-124-1 fru-mir-124-2 tni-mir-124-2 xtr-mir-124 bmo-mir-124
bta-mir-124a mdo-mir-124a-1 mdo-mir-124a-2 mdo-mir-124a-3
The mature miRNA of MI0000443
Mature name
hsa-miR-124a
Mature sequence
52| 5'- UUAAGGCACGCGGUGAAUGCCA -3' |73
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-124a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-124a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000375226 (targeted by hsa-miR-124a, predicted by TargetScan)
retinoblastoma-associated factor 600 [Source:RefSeq_peptide;Acc:NP_065816]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
3. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
4. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 289490 0937119471