keyword in microRNA or target gene :
The pre-miRNA of MI0000442
Gene
HGNC MIRN122A
Accession no
MI0000442
ID
hsa-mir-122a
Species
Homo sapiens
Description
Homo sapiens miR-122a stem-loop
Genomic Location
18 : 54269286 - 54269370 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
85 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-122a hsa-mir-122a rno-mir-122a gga-mir-122a-1 gga-mir-122a-2
dre-mir-122 ssc-mir-122a fru-mir-122 tni-mir-122 xtr-mir-122
bta-mir-122a mdo-mir-122a
The mature miRNA of MI0000442
Mature name
hsa-miR-122a
Mature sequence
15| 5'- UGGAGUGUGACAAUGGUGUUUGU -3' |37
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-122a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-122a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000375753 (targeted by hsa-miR-122a, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 792150 0937119471