keyword in microRNA or target gene :
The pre-miRNA of MI0000438
Gene
HGNC MIRN15B
Accession no
MI0000438
ID
hsa-mir-15b
Species
Homo sapiens
Description
Homo sapiens miR-15b stem-loop
Genomic Location
3 : 161605070 - 161605167 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000360177 intron - 3
ENST00000357388 intron + 5
ENST00000360111 intron + 5
ENST00000344722 intron + 5
OTTHUMT00000266898 intron + 5
OTTHUMT00000266899 intron + 4
OTTHUMT00000266897 intron + 5
OTTHUMT00000266900 intron + 4
View the flanking features in the Genome Browser
Pre-miRNA length
98 nt
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-15b in human [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-15a hsa-mir-16-1 hsa-mir-16-2 mmu-mir-15b mmu-mir-195
hsa-mir-15b hsa-mir-195 mmu-mir-15a mmu-mir-16-1 mmu-mir-16-2
rno-mir-15b rno-mir-16 rno-mir-195 gga-mir-16-1 gga-mir-15a
gga-mir-16-2 gga-mir-15b dre-mir-15a-1 dre-mir-15a-2 dre-mir-15b
dre-mir-16a dre-mir-16b dre-mir-16c dre-mir-457a dre-mir-457b
ssc-mir-15b ggo-mir-15b age-mir-15b ppa-mir-15b ppy-mir-15b
ptr-mir-15b mml-mir-15b lla-mir-15b mne-mir-15b ggo-mir-195
ppa-mir-195 age-mir-15a age-mir-16 ggo-mir-15a ggo-mir-16
mne-mir-15a mne-mir-16 sla-mir-15a sla-mir-16 ppa-mir-15a
ppa-mir-16 lca-mir-15a lca-mir-16 mml-mir-15a mml-mir-16
ppy-mir-15a ppy-mir-16 ptr-mir-15a ptr-mir-16 lla-mir-15a
lla-mir-16 fru-mir-15b tni-mir-15b fru-mir-15a tni-mir-15a
fru-mir-16 tni-mir-16 bta-mir-16 dre-mir-15c xtr-mir-15a
xtr-mir-15b xtr-mir-16c xtr-mir-16a xtr-mir-15c xtr-mir-16b
bta-mir-15b mdo-mir-15a mdo-mir-16 bta-mir-15a bta-mir-195
The mature miRNA of MI0000438
Mature name
hsa-miR-15b
Mature sequence
20| 5'- UAGCAGCACAUCAUGGUUUACA -3' |41
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-15b, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-15b, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-15b, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
3. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 900144 0937119471