keyword in microRNA or target gene :
The pre-miRNA of MI0000433
Gene
HGNC MIRNLET7G
Accession no
MI0000433
ID
hsa-let-7g
Species
Homo sapiens
Description
Homo sapiens let-7g stem-loop
Genomic Location
3 : 52277334 - 52277417 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000296490 intron + 2
ENST00000361447 intron + 2
OTTHUMT00000264972 intron - 1
OTTHUMT00000265046 intron + 2
View the flanking features in the Genome Browser
Pre-miRNA length
84 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-let-7 hsa-let-7a-1 hsa-let-7a-2 hsa-let-7a-3 hsa-let-7b
hsa-let-7c hsa-let-7d hsa-let-7e hsa-let-7f-1 hsa-let-7f-2
hsa-mir-98 mmu-let-7g mmu-let-7i mmu-let-7d dme-let-7
hsa-let-7g hsa-let-7i cbr-let-7 mmu-let-7a-1 mmu-let-7a-2
mmu-let-7b mmu-let-7c-1 mmu-let-7c-2 mmu-let-7e mmu-let-7f-1
mmu-let-7f-2 mmu-mir-98 rno-let-7d rno-let-7a-1 rno-let-7a-2
rno-let-7b rno-let-7c-1 rno-let-7c-2 rno-let-7e rno-let-7f-1
rno-let-7f-2 rno-let-7i rno-mir-98 gga-let-7i gga-let-7a-3
gga-let-7b gga-let-7c gga-let-7g gga-let-7d gga-let-7f
gga-let-7a-1 gga-let-7a-2 gga-let-7j gga-let-7k dps-let-7
aga-let-7 dre-let-7a-1 dre-let-7a-2 dre-let-7a-3 dre-let-7a-4
dre-let-7a-5 dre-let-7a-6 dre-let-7b dre-let-7c-1 dre-let-7c-2
dre-let-7d-1 dre-let-7d-2 dre-let-7e dre-let-7f dre-let-7g-1
dre-let-7g-2 dre-let-7h dre-let-7i ssc-let-7c ssc-let-7f
ssc-let-7i mml-mir-98 ptr-mir-98 ggo-mir-98 ppy-mir-98
age-mir-98 ppa-mir-98 fru-let-7h tni-let-7h fru-let-7e
tni-let-7e fru-let-7a-3 tni-let-7a-3 fru-let-7i tni-let-7i
fru-let-7a-2 tni-let-7a-2 fru-let-7d tni-let-7d fru-let-7j
tni-let-7j dre-let-7j fru-let-7b tni-let-7b fru-let-7a-1
tni-let-7a-1 fru-let-7g tni-let-7g bta-let-7f-2 xtr-let-7b
xtr-mir-98 xtr-let-7c xtr-let-7f xtr-let-7g xtr-let-7i
xtr-let-7e-1 xtr-let-7a xtr-let-7e-2 bmo-let-7 bta-mir-98
bta-let-7d bta-let-7g bta-let-7a-1 bta-let-7f-1 bta-let-7i
mdo-let-7a-2 mdo-let-7g mdo-let-7i mdo-let-7f-2 mdo-let-7a-3
mdo-let-7b mdo-let-7a-1 mdo-let-7f-1 mdo-let-7d bta-let-7a-2
bta-let-7a-3 bta-let-7b bta-let-7c bta-let-7e ame-let-7
The mature miRNA of MI0000433
Mature name
hsa-let-7g
Mature sequence
5| 5'- UGAGGUAGUAGUUUGUACAGU -3' |25
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000374673 (targeted by hsa-let-7g, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
ENST00000374673 (targeted by hsa-let-7g, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
ENST00000311538 (targeted by hsa-let-7g, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 266076 0937119471