keyword in microRNA or target gene :
The pre-miRNA of MI0000301
Gene
HGNC MIRN224
Accession no
MI0000301
ID
hsa-mir-224
Species
Homo sapiens
Description
Homo sapiens miR-224 stem-loop
Genomic Location
X : 150877706 - 150877786 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000370328 intron + 6
ENST00000370325 intron + 6
ENST00000359363 intron + 4
OTTHUMT00000060903 intron + 6
OTTHUMT00000060904 intron + 6
OTTHUMT00000060909 exon + 1
View the flanking features in the Genome Browser
Pre-miRNA length
81 nt
Comments
This miR was identified and ends mapped by cloning from Weri cells in human. The sequence maps to chromosome X. An erratum corrected the originally published name miR-175 to miR-224.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-224 mmu-mir-224 ssc-mir-224 mml-mir-224 ptr-mir-224
ggo-mir-224 ppy-mir-224 mne-mir-224 ppa-mir-224 rno-mir-224
The mature miRNA of MI0000301
Mature name
hsa-miR-224
Mature sequence
8| 5'- CAAGUCACUAGUGGUUCCGUUUA -3' |30
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-224, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-224, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000344008 (targeted by hsa-miR-224, predicted by TargetScan)
Castor homolog 1 zinc finger protein (Castor-related protein) (Zinc finger protein 693). [Source:Uniprot/SWISSPROT;Acc:Q86V15]
 
     
   
 
The reference
Literature
1. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
2. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 111907 0937119471