keyword in microRNA or target gene :
The pre-miRNA of MI0000299
Gene
EMBL AJ550426
HGNC MIRN222
Accession no
MI0000299
ID
hsa-mir-222
Species
Homo sapiens
Description
Homo sapiens miR-222 stem-loop
Genomic Location
X : 45491365 - 45491474 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the ends mapped by cloning. Subsequent cloning studies have also verified the expression of miR-222 in human ES cells. The sequence maps to human chromosome X.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-221 hsa-mir-222 mmu-mir-221 mmu-mir-222 rno-mir-221
rno-mir-222 gga-mir-222 gga-mir-221 dre-mir-221 dre-mir-222
mml-mir-221 ggo-mir-221 ppy-mir-221 ppa-mir-221 age-mir-222
fru-mir-222 tni-mir-222 fru-mir-221 tni-mir-221 bta-mir-221
bta-mir-222 xtr-mir-222 xtr-mir-221 mdo-mir-222a mdo-mir-221
The mature miRNA of MI0000299
Mature name
hsa-miR-222
Mature sequence
69| 5'- AGCUACAUCUGGCUACUGGGUCUC -3' |92
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377565 (targeted by hsa-miR-222, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000377565 (targeted by hsa-miR-222, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-222, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
3. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 809837 0937119471