keyword in microRNA or target gene :
The pre-miRNA of MI0000293
Gene
EMBL AJ550420
HGNC MIRN217
Accession no
MI0000293
ID
hsa-mir-217
Species
Homo sapiens
Description
Homo sapiens miR-217 stem-loop
Genomic Location
2 : 56063606 - 56063715 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 2.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-217 mmu-mir-217 rno-mir-217 gga-mir-217 dre-mir-217-1
dre-mir-217-2 ssc-mir-217 ggo-mir-217 ppa-mir-217 fru-mir-217
tni-mir-217 xtr-mir-217 mdo-mir-217
The mature miRNA of MI0000293
Mature name
hsa-miR-217
Mature sequence
35| 5'- UACUGCAUCAGGAACUGAUUGGAU -3' |58
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000360054 (targeted by hsa-miR-217, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000375753 (targeted by hsa-miR-217, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000374449 (targeted by hsa-miR-217, predicted by TargetScan)
FUS-interacting serine-arginine-rich protein 1 (TLS-associated protein with Ser-Arg repeats) (TLS-associated protein with SR repeats) (TASR) (TLS-associated serine-arginine protein) (TLS-associated SR protein) (40 kDa SR-repressor protein) (SRrp40) (Splic [Source:Uniprot/SWISSPROT;Acc:O75494]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 667108 0937119471