keyword in microRNA or target gene :
The pre-miRNA of MI0000292
Gene
EMBL AJ550419
HGNC MIRN216
Accession no
MI0000292
ID
hsa-mir-216
Species
Homo sapiens
Description
Homo sapiens miR-216 stem-loop
Genomic Location
2 : 56069589 - 56069698 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 2.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-216 mmu-mir-216a rno-mir-216 gga-mir-216 dre-mir-216a-1
dre-mir-216a-2 dre-mir-216b-1 dre-mir-216b-2 ssc-mir-216 lca-mir-216
ptr-mir-216 ggo-mir-216 ppy-mir-216 ppa-mir-216 fru-mir-216a
tni-mir-216a fru-mir-216b tni-mir-216b mmu-mir-216b xtr-mir-216
mdo-mir-216
The mature miRNA of MI0000292
Mature name
hsa-miR-216
Mature sequence
19| 5'- UAAUCUCAGCUGGCAACUGUG -3' |39
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-216, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-216, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000374732 (targeted by hsa-miR-216, predicted by TargetScan)
Ubiquitin carboxyl-terminal hydrolase 48 (EC 3.1.2.15) (Ubiquitin thioesterase 48) (Ubiquitin-specific-processing protease 48) (Deubiquitinating enzyme 48). [Source:Uniprot/SWISSPROT;Acc:Q86UV5]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 143994 0937119471