keyword in microRNA or target gene :
The pre-miRNA of MI0000291
Gene
EMBL AJ550418
HGNC MIRN215
Accession no
MI0000291
ID
hsa-mir-215
Species
Homo sapiens
Description
Homo sapiens miR-215 stem-loop
Genomic Location
1 : 218357818 - 218357927 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000366922 intron - 12
ENST00000302637 intron - 12
ENST00000320581 intron - 12
OTTHUMT00000090763 intron - 1
OTTHUMT00000090761 intron - 12
View the flanking features in the Genome Browser
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 1, but its expression has not been experimentally verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-192 hsa-mir-215 mmu-mir-192 rno-mir-192 mmu-mir-215
gga-mir-215 dre-mir-192 mml-mir-215 ptr-mir-215 ppy-mir-215
ggo-mir-215 mne-mir-215 fru-mir-192 tni-mir-192 rno-mir-215
xtr-mir-192 xtr-mir-215 bta-mir-215 bta-mir-192
The mature miRNA of MI0000291
Mature name
hsa-miR-215
Mature sequence
27| 5'- AUGACCUAUGAAUUGACAGAC -3' |47
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-215, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-215, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000373019 (targeted by hsa-miR-215, predicted by TargetScan)
Splicing factor 3A subunit 3 (Spliceosome-associated protein 61) (SAP 61) (SF3a60). [Source:Uniprot/SWISSPROT;Acc:Q12874]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 969630 0937119471