keyword in microRNA or target gene :
The pre-miRNA of MI0000290
Gene
EMBL AJ550417
HGNC MIRN214
Accession no
MI0000290
ID
hsa-mir-214
Species
Homo sapiens
Description
Homo sapiens miR-214 stem-loop
Genomic Location
1 : 170374561 - 170374670 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000355305 intron - 16
ENST00000358155 intron - 15
ENST00000367731 intron - 14
ENST00000367730 intron - 15
OTTHUMT00000084531 intron - 15
OTTHUMT00000084529 intron - 14
View the flanking features in the Genome Browser
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 1.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-214 mmu-mir-214 rno-mir-214 dre-mir-214 ssc-mir-214
ggo-mir-214 age-mir-214 ppa-mir-214 ppy-mir-214 ptr-mir-214
mml-mir-214 sla-mir-214 mne-mir-214 fru-mir-214 tni-mir-214
xtr-mir-214 bta-mir-214 mdo-mir-214
The mature miRNA of MI0000290
Mature name
hsa-miR-214
Mature sequence
71| 5'- ACAGCAGGCACAGACAGGCAG -3' |91
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378322 (targeted by hsa-miR-214, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000378317 (targeted by hsa-miR-214, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000378320 (targeted by hsa-miR-214, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 582924 0937119471