keyword in microRNA or target gene :
The pre-miRNA of MI0000287
Gene
EMBL AJ550414
HGNC MIRN211
Accession no
MI0000287
ID
hsa-mir-211
Species
Homo sapiens
Description
Homo sapiens miR-211 stem-loop
Genomic Location
15 : 29144527 - 29144636 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000256552 intron + 6
OTTHUMT00000271467 intron + 6
OTTHUMT00000271466 intron + 6
View the flanking features in the Genome Browser
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 15.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-204 hsa-mir-204 hsa-mir-211 mmu-mir-211 rno-mir-204
rno-mir-211 gga-mir-204-2 gga-mir-204-1 dre-mir-204-1 dre-mir-204-2
dre-mir-204-3 ssc-mir-204 ptr-mir-204 ggo-mir-204 ppy-mir-204
sla-mir-204 mne-mir-204 ppa-mir-204 mml-mir-211 ppy-mir-211
mne-mir-211 tni-mir-204b fru-mir-204 tni-mir-204a gga-mir-211
xtr-mir-204-2 xtr-mir-204-1 mdo-mir-204 bta-mir-204
The mature miRNA of MI0000287
Mature name
hsa-miR-211
Mature sequence
26| 5'- UUCCCUUUGUCAUCCUUCGCCU -3' |47
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-211, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000337907 (targeted by hsa-miR-211, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000337907 (targeted by hsa-miR-211, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 584448 0937119471