keyword in microRNA or target gene :
The pre-miRNA of MI0000286
Gene
EMBL AJ550413
HGNC MIRN210
Accession no
MI0000286
ID
hsa-mir-210
Species
Homo sapiens
Description
Homo sapiens miR-210 stem-loop
Genomic Location
11 : 558089 - 558198 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2]. The sequence maps to human chromosome 11.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-210 dme-mir-210 mmu-mir-210 rno-mir-210 dps-mir-210
dre-mir-210 ame-mir-210 aga-mir-210 fru-mir-210 tni-mir-210
xtr-mir-210 bta-mir-210
The mature miRNA of MI0000286
Mature name
hsa-miR-210
Mature sequence
66| 5'- CUGUGCGUGUGACAGCGGCUGA -3' |87
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000360054 (targeted by hsa-miR-210, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000377565 (targeted by hsa-miR-210, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000377565 (targeted by hsa-miR-210, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 69073 0937119471