keyword in microRNA or target gene :
The pre-miRNA of MI0000285
Gene
HGNC MIRN205
Accession no
MI0000285
ID
hsa-mir-205
Species
Homo sapiens
Description
Homo sapiens miR-205 stem-loop
Genomic Location
1 : 207672101 - 207672210 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000367032 3UTR + 2
OTTHUMT00000088233 exon + 4
OTTHUMT00000088231 exon + 2
OTTHUMT00000088522 intron + 3
OTTHUMT00000088519 exon + 4
OTTHUMT00000098592 exon + 4
OTTHUMT00000088232 exon + 5
View the flanking features in the Genome Browser
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 1.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-205 hsa-mir-205 rno-mir-205 gga-mir-205b gga-mir-205a
dre-mir-205 ssc-mir-205 ggo-mir-205 age-mir-205 ppa-mir-205
ptr-mir-205 lla-mir-205 mne-mir-205 fru-mir-205 tni-mir-205
bta-mir-205 xtr-mir-205b xtr-mir-205a
The mature miRNA of MI0000285
Mature name
hsa-miR-205
Mature sequence
34| 5'- UCCUUCAUUCCACCGGAGUCUG -3' |55
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-205, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-205, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-205, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 259015 0937119471