keyword in microRNA or target gene :
The pre-miRNA of MI0000283
Gene
HGNC MIRN203
Accession no
MI0000283
ID
hsa-mir-203
Species
Homo sapiens
Description
Homo sapiens miR-203 stem-loop
Genomic Location
14 : 103653495 - 103653604 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 14.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-203 hsa-mir-203 rno-mir-203 gga-mir-203 dre-mir-203a
dre-mir-203b fru-mir-203 tni-mir-203 xtr-mir-203 mdo-mir-203
The mature miRNA of MI0000283
Mature name
hsa-miR-203
Mature sequence
65| 5'- GUGAAAUGUUUAGGACCACUAG -3' |86
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-203, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000374343 (targeted by hsa-miR-203, predicted by TargetScan)
Macoilin (Transmembrane protein 57). [Source:Uniprot/SWISSPROT;Acc:Q8N5G2]
 
     
ENST00000374150 (targeted by hsa-miR-203, predicted by TargetScan)
AT-rich interactive domain-containing protein 1A (ARID domain- containing protein 1A) (SWI/SNF-related, matrix-associated, actin- dependent regulator of chromatin subfamily F member 1) (SWI-SNF complex protein p270) (B120) (SWI-like protein) (Osa homolog [Source:Uniprot/SWISSPROT;Acc:O14497]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 880134 0937119471