keyword in microRNA or target gene :
The pre-miRNA of MI0000282
Gene
EMBL AJ550412
HGNC MIRN199B
Accession no
MI0000282
ID
hsa-mir-199b
Species
Homo sapiens
Description
Homo sapiens miR-199b stem-loop
Genomic Location
9 : 130046821 - 130046930 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000341179 intron - 15
ENST00000372923 intron - 16
ENST00000359070 intron - 15
OTTHUMT00000054368 intron - 15
OTTHUMT00000054367 intron - 15
OTTHUMT00000054369 intron - 5
OTTHUMT00000259166 intron - 14
OTTHUMT00000054372 intron - 2
OTTHUMT00000054371 intron - 2
View the flanking features in the Genome Browser
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 9.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-199a-1 hsa-mir-199a-1 hsa-mir-199a-2 hsa-mir-199b mmu-mir-199a-2
mmu-mir-199b rno-mir-199a gga-mir-199-2 gga-mir-199-1 dre-mir-199-1
dre-mir-199-2 dre-mir-199-3 ggo-mir-199a ppa-mir-199a ppy-mir-199a
ptr-mir-199a mml-mir-199a sla-mir-199a lla-mir-199a mne-mir-199a
fru-mir-199-3 tni-mir-199-3 fru-mir-199-2 tni-mir-199-2 fru-mir-199-1
tni-mir-199-1 bta-mir-199a xtr-mir-199a xtr-mir-199b bta-mir-199b
mdo-mir-199b
The mature miRNA of MI0000282
Mature name
hsa-miR-199b
Mature sequence
26| 5'- CCCAGUGUUUAGACUAUCUGUUC -3' |48
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-199b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000337907 (targeted by hsa-miR-199b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-199b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 773537 0937119471