keyword in microRNA or target gene :
The pre-miRNA of MI0000281
Gene
EMBL AJ560756
HGNC MIRN199A2
Accession no
MI0000281
ID
hsa-mir-199a-2
Species
Homo sapiens
Description
Homo sapiens miR-199a-2 stem-loop
Genomic Location
1 : 170380298 - 170380407 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000355305 intron - 16
ENST00000358155 intron - 15
ENST00000367731 intron - 14
ENST00000367730 intron - 15
OTTHUMT00000084531 intron - 15
OTTHUMT00000084529 intron - 14
View the flanking features in the Genome Browser
Pre-miRNA length
110 nt
Comments
Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2, MIR:MI0000281).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-199a-1 hsa-mir-199a-1 hsa-mir-199a-2 hsa-mir-199b mmu-mir-199a-2
mmu-mir-199b rno-mir-199a gga-mir-199-2 gga-mir-199-1 dre-mir-199-1
dre-mir-199-2 dre-mir-199-3 ggo-mir-199a ppa-mir-199a ppy-mir-199a
ptr-mir-199a mml-mir-199a sla-mir-199a lla-mir-199a mne-mir-199a
fru-mir-199-3 tni-mir-199-3 fru-mir-199-2 tni-mir-199-2 fru-mir-199-1
tni-mir-199-1 bta-mir-199a xtr-mir-199a xtr-mir-199b bta-mir-199b
mdo-mir-199b
The mature miRNA of MI0000281
Mature name
hsa-miR-199a
Mature sequence
31| 5'- CCCAGUGUUCAGACUACCUGUUC -3' |53
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-199a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-199a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000360563 (targeted by hsa-miR-199a, predicted by TargetScan)
Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta isoform (EC 2.7.1.153) (PI3-kinase p110 subunit delta) (PtdIns-3- kinase p110) (PI3K) (p110delta). [Source:Uniprot/SWISSPROT;Acc:O00329]
 
     
   
 
The mature miRNA of MI0000281
Mature name
hsa-miR-199a*
Mature sequence
69| 5'- UACAGUAGUCUGCACAUUGGUU -3' |90
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000376838 (targeted by hsa-miR-199a*, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
ENST00000361445 (targeted by hsa-miR-199a*, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
ENST00000361947 (targeted by hsa-miR-199a*, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
3. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 404974 0937119471