keyword in microRNA or target gene :
The pre-miRNA of MI0000279
Gene
EMBL AJ560753
HGNC MIRN196A2
Accession no
MI0000279
ID
hsa-mir-196a-2
Species
Homo sapiens
Description
Homo sapiens miR-196a-2 stem-loop
Genomic Location
12 : 52671789 - 52671898 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 12. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-196a-1 hsa-mir-196a-2 mmu-mir-196a-1 mmu-mir-196a-2 rno-mir-196a
hsa-mir-196b mmu-mir-196b rno-mir-196b gga-mir-196-2 gga-mir-196-1
gga-mir-196-3 dre-mir-196a-1 dre-mir-196a-2 dre-mir-196b ssc-mir-196
mml-mir-196 ggo-mir-196-1 ppy-mir-196-1 ptr-mir-196 ggo-mir-196-2
ppy-mir-196-2 lla-mir-196 age-mir-196 ppa-mir-196 fru-mir-196a-2
tni-mir-196a-2 fru-mir-196a-1 tni-mir-196a-1 fru-mir-196b tni-mir-196b
xtr-mir-196a xtr-mir-196b mdo-mir-196b
The mature miRNA of MI0000279
Mature name
hsa-miR-196a
Mature sequence
25| 5'- UAGGUAGUUUCAUGUUGUUGG -3' |45
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-196a, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000373633 (targeted by hsa-miR-196a, predicted by TargetScan)
Transmembrane protein 39B. [Source:Uniprot/SWISSPROT;Acc:Q9GZU3]
 
     
ENST00000371843 (targeted by hsa-miR-196a, predicted by TargetScan)
Spermatogenesis-associated protein 6 precursor. [Source:Uniprot/SWISSPROT;Acc:Q9NWH7]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "MicroRNA-directed cleavage of HOXB8 mRNA"
  Yekta S, Shih IH, Bartel DP
  Science. 304:594-596(2004).
3. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 717 0937119471