keyword in microRNA or target gene :
The pre-miRNA of MI0000274
Gene
HGNC MIRN187
Accession no
MI0000274
ID
hsa-mir-187
Species
Homo sapiens
Description
Homo sapiens miR-187 stem-loop
Genomic Location
18 : 31738779 - 31738887 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
109 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined but assigned based on the mouse homologue (MIR:MI0000229). The sequence maps to human chromosome 18.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-187 hsa-mir-187 rno-mir-187 gga-mir-187 dre-mir-187
ggo-mir-187 ppy-mir-187 mne-mir-187 ppa-mir-187 fru-mir-187
tni-mir-187 xtr-mir-187 mdo-mir-187
The mature miRNA of MI0000274
Mature name
hsa-miR-187
Mature sequence
71| 5'- UCGUGUCUUGUGUUGCAGCCG -3' |91
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-187, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000264203 (targeted by hsa-miR-187, predicted by TargetScan)
F-actin capping protein subunit beta (CapZ beta). [Source:Uniprot/SWISSPROT;Acc:P47756]
 
     
ENST00000375142 (targeted by hsa-miR-187, predicted by TargetScan)
F-actin capping protein subunit beta (CapZ beta). [Source:Uniprot/SWISSPROT;Acc:P47756]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 513199 0937119471