keyword in microRNA or target gene :
The pre-miRNA of MI0000273
Gene
HGNC MIRN183
Accession no
MI0000273
ID
hsa-mir-183
Species
Homo sapiens
Description
Homo sapiens miR-183 stem-loop
Genomic Location
7 : 129201981 - 129202090 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined but assigned based on the mouse homologue (MIR:MI0000225). The sequence maps to human chromosome 7.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-183 hsa-mir-183 rno-mir-183 gga-mir-183 dre-mir-183
ssc-mir-183 mml-mir-183 ptr-mir-183 ggo-mir-183 sla-mir-183
mne-mir-183 ppa-mir-183 fru-mir-183 tni-mir-183 xtr-mir-183
mdo-mir-183
The mature miRNA of MI0000273
Mature name
hsa-miR-183
Mature sequence
27| 5'- UAUGGCACUGGUAGAAUUCACUG -3' |49
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377725 (targeted by hsa-miR-183, predicted by TargetScan)
Tumor necrosis factor receptor superfamily member 25 precursor (WSL-1 protein) (Apoptosis-mediating receptor DR3) (Apoptosis-mediating receptor TRAMP) (Death domain receptor 3) (WSL protein) (Apoptosis- inducing receptor AIR) (Apo-3) (Lymphocyte-associate [Source:Uniprot/SWISSPROT;Acc:Q93038]
 
     
ENST00000355249 (targeted by hsa-miR-183, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377083 (targeted by hsa-miR-183, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 433267 0937119471