keyword in microRNA or target gene :
The pre-miRNA of MI0000272
Gene
HGNC MIRN182
Accession no
MI0000272
ID
hsa-mir-182
Species
Homo sapiens
Description
Homo sapiens miR-182 stem-loop
Genomic Location
7 : 129197459 - 129197568 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined but assigned based on the mouse homologue (MI:MI0000224). A less predominantly expressed miR was identified originating from the opposite arm of the precursor (designated miR-182*). The sequence maps to human chromosome 7.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-182 hsa-mir-182 dre-mir-182 mml-mir-182 ppy-mir-182
fru-mir-182 tni-mir-182 xtr-mir-182 mdo-mir-182
The mature miRNA of MI0000272
Mature name
hsa-miR-182
Mature sequence
23| 5'- UUUGGCAAUGGUAGAACUCACA -3' |44
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-182, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-182, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000374673 (targeted by hsa-miR-182, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The mature miRNA of MI0000272
Mature name
hsa-miR-182*
Mature sequence
67| 5'- UGGUUCUAGACUUGCCAACUA -3' |87
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000355249 (targeted by hsa-miR-182*, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000374449 (targeted by hsa-miR-182*, predicted by TargetScan)
FUS-interacting serine-arginine-rich protein 1 (TLS-associated protein with Ser-Arg repeats) (TLS-associated protein with SR repeats) (TASR) (TLS-associated serine-arginine protein) (TLS-associated SR protein) (40 kDa SR-repressor protein) (SRrp40) (Splic [Source:Uniprot/SWISSPROT;Acc:O75494]
 
     
ENST00000338597 (targeted by hsa-miR-182*, predicted by TargetScan)
FUS-interacting serine-arginine-rich protein 1 (TLS-associated protein with Ser-Arg repeats) (TLS-associated protein with SR repeats) (TASR) (TLS-associated serine-arginine protein) (TLS-associated SR protein) (40 kDa SR-repressor protein) (SRrp40) (Splic [Source:Uniprot/SWISSPROT;Acc:O75494]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 275502 0937119471