keyword in microRNA or target gene :
The pre-miRNA of MI0000271
Gene
RFAM mir-181
EMBL AJ550411
HGNC MIRN181C
Accession no
MI0000271
ID
hsa-mir-181c
Species
Homo sapiens
Description
Homo sapiens miR-181c stem-loop
Genomic Location
19 : 13846513 - 13846622 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 19.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-181a-2 hsa-mir-181a-2 hsa-mir-181b-1 hsa-mir-181c hsa-mir-181a-1
hsa-mir-181b-2 mmu-mir-181a-1 mmu-mir-181b-1 mmu-mir-181c mmu-mir-181b-2
rno-mir-181c rno-mir-181a-2 rno-mir-181b-1 rno-mir-181b-2 rno-mir-181a-1
gga-mir-181a-1 gga-mir-181b-1 gga-mir-181b-2 gga-mir-181a-2 dre-mir-181b-1
dre-mir-181b-2 dre-mir-181a-1 dre-mir-181c ssc-mir-181b ssc-mir-181c
ggo-mir-181a-2 ppa-mir-181a-2 ptr-mir-181a-2 mml-mir-181a-2 sla-mir-181a-2
mne-mir-181a-2 mml-mir-181c ptr-mir-181c ggo-mir-181c ppa-mir-181c
mml-mir-181a-1 mml-mir-181b ptr-mir-181a-1 ptr-mir-181b ppy-mir-181a-1
ppy-mir-181b ggo-mir-181a-1 ggo-mir-181b lla-mir-181a-1 lla-mir-181b
mne-mir-181a-1 mne-mir-181b ppa-mir-181a-1 ppa-mir-181b hsa-mir-181d
fru-mir-181b-1 tni-mir-181b-1 fru-mir-181a-1 tni-mir-181a-1 fru-mir-181b-2
tni-mir-181b-2 tni-mir-181a-2 dre-mir-181a-2 fru-mir-181a-2 bta-mir-181a
xtr-mir-181b-1 xtr-mir-181b-2 xtr-mir-181a-1 xtr-mir-181a-2 bta-mir-181b
bta-mir-181c mdo-mir-181c mdo-mir-181a mdo-mir-181b mmu-mir-181d
The mature miRNA of MI0000271
Mature name
hsa-miR-181c
Mature sequence
27| 5'- AACAUUCAACCUGUCGGUGAGU -3' |48
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-181c, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000337907 (targeted by hsa-miR-181c, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-181c, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 236639 0937119471