keyword in microRNA or target gene :
The pre-miRNA of MI0000268
Gene
EMBL AJ550399
EMBL AY194151
HGNC MIRN34A
Accession no
MI0000268
ID
hsa-mir-34a
Species
Homo sapiens
Description
Homo sapiens miR-34a stem-loop
Genomic Location
1 : 9134314 - 9134423 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Dostie et al. independently cloned this sequence in human but misnamed the sequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis) [2]. The sequence maps to human chromosome 1. Human miR-34a was previously named miR-34 here and in [1], but is renamed to clarify homology with the alternatively named mouse sequence (MIR:MI0000584).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-34 hsa-mir-34a dme-mir-34 mmu-mir-34c mmu-mir-34b
cbr-mir-34 mmu-mir-34a hsa-mir-34b hsa-mir-34c rno-mir-34b
rno-mir-34c rno-mir-34a gga-mir-34a gga-mir-34b gga-mir-34c
dps-mir-34 dre-mir-34 ggo-mir-34a age-mir-34a ppa-mir-34a
ppy-mir-34a ptr-mir-34a mml-mir-34a sla-mir-34a lla-mir-34a
mne-mir-34a dre-mir-34b bta-mir-34b dre-mir-34c xtr-mir-34a
xtr-mir-34b-2 xtr-mir-34b-4 xtr-mir-34b-3 xtr-mir-34b-1 bmo-mir-34
bta-mir-34c mdo-mir-34a bta-mir-34a ame-mir-34
The mature miRNA of MI0000268
Mature name
hsa-miR-34a
Mature sequence
22| 5'- UGGCAGUGUCUUAGCUGGUUGUU -3' |44
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000338591 (targeted by hsa-miR-34a, predicted by TargetScan)
Kelch-like protein 17 (Actinfilin). [Source:Uniprot/SWISSPROT;Acc:Q6TDP4]
 
     
ENST00000379420 (targeted by hsa-miR-34a, predicted by TargetScan)
Kelch-like protein 17 (Actinfilin). [Source:Uniprot/SWISSPROT;Acc:Q6TDP4]
 
     
ENST00000377565 (targeted by hsa-miR-34a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 485997 0937119471