keyword in microRNA or target gene :
The pre-miRNA of MI0000267
Gene
RFAM mir-10
EMBL AJ550395
HGNC MIRN10B
Accession no
MI0000267
ID
hsa-mir-10b
Species
Homo sapiens
Description
Homo sapiens miR-10b stem-loop
Genomic Location
2 : 176723277 - 176723386 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 2. Michael et al. subsequently verified expression of miR-10b in human [2]. The sequence is offset by 2 nt with respect to that cloned in mouse (MIR:MI0000221).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-10 mmu-mir-10b hsa-mir-10a hsa-mir-10b mmu-mir-10a
rno-mir-10a rno-mir-10b gga-mir-10b dps-mir-10 dre-mir-10a
dre-mir-10b-1 aga-mir-10 dre-mir-10b-2 dre-mir-10c dre-mir-10d-1
dre-mir-10d-2 ggo-mir-10a ppy-mir-10a sla-mir-10a age-mir-10a
ppa-mir-10a ggo-mir-10b mne-mir-10b ppa-mir-10b fru-mir-10b-1
tni-mir-10b-2 fru-mir-10b-2 tni-mir-10b-1 fru-mir-10c tni-mir-10c
xtr-mir-10a xtr-mir-10b xtr-mir-10c tni-mir-10d fru-mir-10d
bmo-mir-10 bta-mir-10a bta-mir-10b mdo-mir-10a mdo-mir-10b
ame-mir-10
The mature miRNA of MI0000267
Mature name
hsa-miR-10b
Mature sequence
27| 5'- UACCCUGUAGAACCGAAUUUGU -3' |48
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000356315 (targeted by hsa-miR-10b, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000011700 (targeted by hsa-miR-10b, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000358136 (targeted by hsa-miR-10b, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 321779 0937119471