keyword in microRNA or target gene :
The pre-miRNA of MI0000266
Gene
RFAM mir-10
EMBL AJ550394
HGNC MIRN10A
Accession no
MI0000266
ID
hsa-mir-10a
Species
Homo sapiens
Description
Homo sapiens miR-10a stem-loop
Genomic Location
17 : 44012199 - 44012308 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 17.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-10 mmu-mir-10b hsa-mir-10a hsa-mir-10b mmu-mir-10a
rno-mir-10a rno-mir-10b gga-mir-10b dps-mir-10 dre-mir-10a
dre-mir-10b-1 aga-mir-10 dre-mir-10b-2 dre-mir-10c dre-mir-10d-1
dre-mir-10d-2 ggo-mir-10a ppy-mir-10a sla-mir-10a age-mir-10a
ppa-mir-10a ggo-mir-10b mne-mir-10b ppa-mir-10b fru-mir-10b-1
tni-mir-10b-2 fru-mir-10b-2 tni-mir-10b-1 fru-mir-10c tni-mir-10c
xtr-mir-10a xtr-mir-10b xtr-mir-10c tni-mir-10d fru-mir-10d
bmo-mir-10 bta-mir-10a bta-mir-10b mdo-mir-10a mdo-mir-10b
ame-mir-10
The mature miRNA of MI0000266
Mature name
hsa-miR-10a
Mature sequence
22| 5'- UACCCUGUAGAUCCGAAUUUGUG -3' |44
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377260 (targeted by hsa-miR-10a, predicted by TargetScan)
Beta-catenin-interacting protein 1 (Inhibitor of beta-catenin and Tcf- 4). [Source:Uniprot/SWISSPROT;Acc:Q9NSA3]
 
     
ENST00000356315 (targeted by hsa-miR-10a, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000011700 (targeted by hsa-miR-10a, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 373438 0937119471