keyword in microRNA or target gene :
The pre-miRNA of MI0000262
Gene
HGNC MIRN147
Accession no
MI0000262
ID
hsa-mir-147
Species
Homo sapiens
Description
Homo sapiens miR-147 stem-loop
Genomic Location
9 : 122047078 - 122047149 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
72 nt
Comments
Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue [1], but the sequence is not present in the mouse genome assembly (NCBI32). The human genome sequence contains a predicted precursor hairpin for miR-147 shown in [1] (supplementary information) and represented here. The expression of miR-147 has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-147 ptr-mir-147 ppy-mir-147 sla-mir-147 mne-mir-147
ppa-mir-147 gga-mir-147-1 gga-mir-147-2
The mature miRNA of MI0000262
Mature name
hsa-miR-147
Mature sequence
47| 5'- GUGUGUGGAAAUGCUUCUGC -3' |66
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-147, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-147, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-147, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 655473 0937119471