keyword in microRNA or target gene :
The pre-miRNA of MI0000255
Gene
HGNC MIRN30D
Accession no
MI0000255
ID
hsa-mir-30d
Species
Homo sapiens
Description
Homo sapiens miR-30d stem-loop
Genomic Location
8 : 135886301 - 135886370 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
70 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-30a mmu-mir-30a mmu-mir-30b hsa-mir-30c-2 hsa-mir-30d
mmu-mir-30e hsa-mir-30b mmu-mir-30c-1 mmu-mir-30c-2 mmu-mir-30d
hsa-mir-30c-1 hsa-mir-30e rno-mir-30c-1 rno-mir-30e rno-mir-30b
rno-mir-30d rno-mir-30a rno-mir-30c-2 gga-mir-30d gga-mir-30b
gga-mir-30a gga-mir-30c-2 gga-mir-30e gga-mir-30c-1 dre-mir-30a
dre-mir-30b dre-mir-30c dre-mir-30d dre-mir-30e-2 ssc-mir-30c
mml-mir-30b ptr-mir-30b ggo-mir-30b lla-mir-30b mne-mir-30b
age-mir-30b ppa-mir-30b mml-mir-30a ptr-mir-30a ggo-mir-30a
ppy-mir-30a ppa-mir-30a ptr-mir-30c lla-mir-30c mne-mir-30c
ptr-mir-30d ggo-mir-30d mne-mir-30d ppa-mir-30d fru-mir-30b
tni-mir-30b fru-mir-30d tni-mir-30d fru-mir-30c tni-mir-30c
bta-mir-30d bta-mir-30b xtr-mir-30a xtr-mir-30b xtr-mir-30c-1
xtr-mir-30d xtr-mir-30c-2 xtr-mir-30e bta-mir-30e bta-mir-30a
bta-mir-30c mdo-mir-30a
The mature miRNA of MI0000255
Mature name
hsa-miR-30d
Mature sequence
6| 5'- UGUAAACAUCCCCGACUGGAAG -3' |27
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378756 (targeted by hsa-miR-30d, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000378755 (targeted by hsa-miR-30d, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000339113 (targeted by hsa-miR-30d, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 902863 0937119471