keyword in microRNA or target gene :
The pre-miRNA of MI0000253
Gene
HGNC MIRN148A
Accession no
MI0000253
ID
hsa-mir-148a
Species
Homo sapiens
Description
Homo sapiens miR-148a stem-loop
Genomic Location
7 : 25956064 - 25956131 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
68 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-152 hsa-mir-148a hsa-mir-152 mmu-mir-148a rno-mir-148b
mmu-mir-148b hsa-mir-148b rno-mir-152 gga-mir-148a dre-mir-148
dre-mir-152 ssc-mir-148a fru-mir-148 tni-mir-148 fru-mir-152
tni-mir-152 bta-mir-148a xtr-mir-148b xtr-mir-148a bta-mir-148b
mdo-mir-152
The mature miRNA of MI0000253
Mature name
hsa-miR-148a
Mature sequence
44| 5'- UCAGUGCACUACAGAACUUUGU -3' |65
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378567 (targeted by hsa-miR-148a, predicted by TargetScan)
Protein kinase C zeta type (EC 2.7.11.13) (nPKC-zeta). [Source:Uniprot/SWISSPROT;Acc:Q05513]
 
     
ENST00000337907 (targeted by hsa-miR-148a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-148a, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 774870 0937119471