keyword in microRNA or target gene :
The pre-miRNA of MI0000252
Gene
EMBL AJ560751
HGNC MIRN129-1
Accession no
MI0000252
ID
hsa-mir-129-1
Species
Homo sapiens
Description
Homo sapiens miR-129-1 stem-loop
Genomic Location
7 : 127635161 - 127635232 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
72 nt
Comments
This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MIR:MI0000473) and mouse (MIR:MI0000222 and MIR:MI0000585). This sequence maps to human chromosome 7.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-129-1 hsa-mir-129-1 hsa-mir-129-2 mmu-mir-129-2 rno-mir-129-2
rno-mir-129-1 dre-mir-129-2 dre-mir-129-1 fru-mir-129-1 tni-mir-129-1
fru-mir-129-2 tni-mir-129-2 xtr-mir-129-1 xtr-mir-129-2 mdo-mir-129
The mature miRNA of MI0000252
Mature name
hsa-miR-129
Mature sequence
5| 5'- CUUUUUGCGGUCUGGGCUUGC -3' |25
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377565 (targeted by hsa-miR-129, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000377565 (targeted by hsa-miR-129, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-129, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 146564 0937119471