keyword in microRNA or target gene :
The pre-miRNA of MI0000239
Gene
EMBL AJ560754
HGNC MIRN197
Accession no
MI0000239
ID
hsa-mir-197
Species
Homo sapiens
Description
Homo sapiens miR-197 stem-loop
Genomic Location
1 : 109943038 - 109943112 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
75 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-197 ptr-mir-197 ppy-mir-197 mne-mir-197 age-mir-197
ppa-mir-197
The mature miRNA of MI0000239
Mature name
hsa-miR-197
Mature sequence
48| 5'- UUCACCACCUUCUCCACCCAGC -3' |69
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-197, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-197, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000344008 (targeted by hsa-miR-197, predicted by TargetScan)
Castor homolog 1 zinc finger protein (Castor-related protein) (Zinc finger protein 693). [Source:Uniprot/SWISSPROT;Acc:Q86V15]
 
     
   
 
The reference
Literature
1. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 310241 0937119471