keyword in microRNA or target gene :
The pre-miRNA of MI0000234
Gene
HGNC MIRN192
Accession no
MI0000234
ID
hsa-mir-192
Species
Homo sapiens
Description
Homo sapiens miR-192 stem-loop
Genomic Location
11 : 64415185 - 64415294 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
110 nt
Comments
This human miRNA was identified by two independent groups. Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-192 hsa-mir-215 mmu-mir-192 rno-mir-192 mmu-mir-215
gga-mir-215 dre-mir-192 mml-mir-215 ptr-mir-215 ppy-mir-215
ggo-mir-215 mne-mir-215 fru-mir-192 tni-mir-192 rno-mir-215
xtr-mir-192 xtr-mir-215 bta-mir-215 bta-mir-192
The mature miRNA of MI0000234
Mature name
hsa-miR-192
Mature sequence
24| 5'- CUGACCUAUGAAUUGACAGCC -3' |44
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-192, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-192, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000373019 (targeted by hsa-miR-192, predicted by TargetScan)
Splicing factor 3A subunit 3 (Spliceosome-associated protein 61) (SAP 61) (SF3a60). [Source:Uniprot/SWISSPROT;Acc:Q12874]
 
     
   
 
The reference
Literature
1. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
2. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
3. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 159160 0937119471