keyword in microRNA or target gene :
The pre-miRNA of MI0000115
Gene
EMBL AF480552
EMBL AF480520
EMBL AJ550396
HGNC MIRN16-2
Accession no
MI0000115
ID
hsa-mir-16-2
Species
Homo sapiens
Description
Homo sapiens miR-16-2 stem-loop
Genomic Location
3 : 161605227 - 161605307 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000360177 intron - 3
ENST00000357388 intron + 5
ENST00000360111 intron + 5
ENST00000344722 intron + 5
OTTHUMT00000266898 intron + 5
OTTHUMT00000266899 intron + 4
OTTHUMT00000266897 intron + 5
OTTHUMT00000266900 intron + 4
View the flanking features in the Genome Browser
Pre-miRNA length
81 nt
Comments
This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references [1] and [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-15a hsa-mir-16-1 hsa-mir-16-2 mmu-mir-15b mmu-mir-195
hsa-mir-15b hsa-mir-195 mmu-mir-15a mmu-mir-16-1 mmu-mir-16-2
rno-mir-15b rno-mir-16 rno-mir-195 gga-mir-16-1 gga-mir-15a
gga-mir-16-2 gga-mir-15b dre-mir-15a-1 dre-mir-15a-2 dre-mir-15b
dre-mir-16a dre-mir-16b dre-mir-16c dre-mir-457a dre-mir-457b
ssc-mir-15b ggo-mir-15b age-mir-15b ppa-mir-15b ppy-mir-15b
ptr-mir-15b mml-mir-15b lla-mir-15b mne-mir-15b ggo-mir-195
ppa-mir-195 age-mir-15a age-mir-16 ggo-mir-15a ggo-mir-16
mne-mir-15a mne-mir-16 sla-mir-15a sla-mir-16 ppa-mir-15a
ppa-mir-16 lca-mir-15a lca-mir-16 mml-mir-15a mml-mir-16
ppy-mir-15a ppy-mir-16 ptr-mir-15a ptr-mir-16 lla-mir-15a
lla-mir-16 fru-mir-15b tni-mir-15b fru-mir-15a tni-mir-15a
fru-mir-16 tni-mir-16 bta-mir-16 dre-mir-15c xtr-mir-15a
xtr-mir-15b xtr-mir-16c xtr-mir-16a xtr-mir-15c xtr-mir-16b
bta-mir-15b mdo-mir-15a mdo-mir-16 bta-mir-15a bta-mir-195
The mature miRNA of MI0000115
Mature name
hsa-miR-16
Mature sequence
10| 5'- UAGCAGCACGUAAAUAUUGGCG -3' |31
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-16, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-16, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-16, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
2. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
3. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
4. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
5. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
6. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 846467 0937119471