keyword in microRNA or target gene :
The pre-miRNA of MI0000114
Gene
EMBL AF480550
EMBL AF480505
MIR
EMBL AJ550401
HGNC MIRN107
Accession no
MI0000114
ID
hsa-mir-107
Species
Homo sapiens
Description
Homo sapiens miR-107 stem-loop
Genomic Location
10 : 91342484 - 91342564 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000307534 intron + 4
ENST00000342512 intron + 5
ENST00000322191 intron + 4
ENST00000371775 intron + 5
ENST00000371774 intron + 5
OTTHUMT00000049317 intron + 5
OTTHUMT00000049318 intron + 4
View the flanking features in the Genome Browser
Pre-miRNA length
81 nt
Comments
This miRNA was not cloned, rather it was identified by homology to miR-103. This sequence is localised to chromosome 10 and was named mir-107-10 in reference [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-103-2 hsa-mir-103-1 hsa-mir-107 mmu-mir-103-1 mmu-mir-103-2
mmu-mir-107 rno-mir-103-2 rno-mir-103-1 rno-mir-107 gga-mir-103-2
gga-mir-107 gga-mir-103-1 dre-mir-103 dre-mir-107 ssc-mir-103
ssc-mir-107 age-mir-103 ggo-mir-103 ppa-mir-103 ppy-mir-103
ptr-mir-103 mml-mir-103 lla-mir-103 mne-mir-103 mml-mir-107
ptr-mir-107 ggo-mir-107 ppy-mir-107 lla-mir-107 mne-mir-107
ppa-mir-107 fru-mir-103 tni-mir-103 fru-mir-107 tni-mir-107
bta-mir-103-1 xtr-mir-107 xtr-mir-103-1 xtr-mir-103-2 bta-mir-107
mdo-mir-103-1 mdo-mir-103-2 mdo-mir-107 bta-mir-103-2
The mature miRNA of MI0000114
Mature name
hsa-miR-107
Mature sequence
50| 5'- AGCAGCAUUGUACAGGGCUAUCA -3' |72
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-107, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-107, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000344008 (targeted by hsa-miR-107, predicted by TargetScan)
Castor homolog 1 zinc finger protein (Castor-related protein) (Zinc finger protein 693). [Source:Uniprot/SWISSPROT;Acc:Q86V15]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 701042 0937119471