keyword in microRNA or target gene :
The pre-miRNA of MI0000113
Gene
EMBL AF480549
EMBL AF480504
MIR
RFAM mir-17
EMBL AJ550400
HGNC MIRN106A
Accession no
MI0000113
ID
hsa-mir-106a
Species
Homo sapiens
Description
Homo sapiens miR-106a stem-loop
Genomic Location
X : 133131894 - 133131974 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
81 nt
Comments
This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-17 hsa-mir-18a hsa-mir-20a hsa-mir-93 hsa-mir-106a
mmu-mir-106a mmu-mir-106b mmu-mir-18 mmu-mir-20a mmu-mir-93
rno-mir-20a mmu-mir-17 hsa-mir-106b rno-mir-17 rno-mir-18
rno-mir-93 rno-mir-106b gga-mir-20a gga-mir-18a gga-mir-17
gga-mir-18b gga-mir-106 xla-mir-20 xla-mir-18 gga-mir-20b
hsa-mir-18b hsa-mir-20b dre-mir-17a-1 dre-mir-17a-2 dre-mir-20b
dre-mir-18a dre-mir-18b dre-mir-18c dre-mir-20a dre-mir-93
ssc-mir-106a ssc-mir-20 ssc-mir-18 ggo-mir-17 ggo-mir-18
ggo-mir-20 lca-mir-17 lca-mir-18 lca-mir-20 age-mir-17
age-mir-18 age-mir-20 ppa-mir-17 ppa-mir-18 ppa-mir-20
ppy-mir-17 ppy-mir-18 ppy-mir-20 ptr-mir-17 ptr-mir-18
ptr-mir-20 mml-mir-17 mml-mir-18 mml-mir-20 sla-mir-17
sla-mir-18 sla-mir-20 lla-mir-17 lla-mir-18 lla-mir-20
mne-mir-17 mne-mir-18 mne-mir-20 ggo-mir-106b ggo-mir-93
age-mir-106b age-mir-93 ppa-mir-106b ppa-mir-93 ppy-mir-106b
ppy-mir-93 ptr-mir-106b ptr-mir-93 mml-mir-106b mml-mir-93
sla-mir-106b sla-mir-93 lla-mir-106b lla-mir-93 mne-mir-106b
mne-mir-93 ggo-mir-106a age-mir-106a ppa-mir-106a mml-mir-106a
ppy-mir-106a ptr-mir-106a sla-mir-106a mne-mir-106a fru-mir-17-1
tni-mir-17-1 fru-mir-18 tni-mir-18 fru-mir-17-2 tni-mir-17-2
fru-mir-20 tni-mir-20 mmu-mir-20b rno-mir-20b bta-mir-18b
bta-mir-18a bta-mir-20a xtr-mir-17 xtr-mir-106 xtr-mir-18a
xtr-mir-93a xtr-mir-93b xtr-mir-20a xtr-mir-18b xtr-mir-20b
bta-mir-106 bta-mir-20b bta-mir-17 bta-mir-93 mdo-mir-17
mdo-mir-18 mdo-mir-20 mdo-mir-93
The mature miRNA of MI0000113
Mature name
hsa-miR-106a
Mature sequence
13| 5'- AAAAGUGCUUACAGUGCAGGUAGC -3' |36
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-106a, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-106a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-106a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
2. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 42547 0937119471