keyword in microRNA or target gene :
The pre-miRNA of MI0000112
Gene
EMBL AF480548
EMBL AF480503
HGNC MIRN105-2
Accession no
MI0000112
ID
hsa-mir-105-2
Species
Homo sapiens
Description
Homo sapiens miR-105-2 stem-loop
Genomic Location
X : 151313540 - 151313620 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000370314 intron + 1
ENST00000370311 intron + 1
OTTHUMT00000060922 intron + 1
OTTHUMT00000060921 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
81 nt
Comments
Mourelatos et al. [1] reported two identical predicted stem loop sequences located on chromosome X, which they named mir-105-X.1 and mir-105-X.2. These sequences have been renamed mir-105-1 (MIR:MI0000111) and mir-105-2 (MIR:MI0000112) here. mir-105-2 differs slightly from that published in [1] and deposited in EMBL (EMBL:AF480548).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-105-1 hsa-mir-105-2 ssc-mir-105-1 ssc-mir-105-2 ppy-mir-105
ggo-mir-105 ppa-mir-105 ptr-mir-105 mml-mir-105 sla-mir-105
lla-mir-105 mne-mir-105
The mature miRNA of MI0000112
Mature name
hsa-miR-105
Mature sequence
13| 5'- UCAAAUGCUCAGACUCCUGU -3' |32
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377565 (targeted by hsa-miR-105, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-105, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000240185 (targeted by hsa-miR-105, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 961358 0937119471