keyword in microRNA or target gene :
The pre-miRNA of MI0000108
Gene
EMBL AF480544
EMBL AF480501
HGNC MIRN103-2
Accession no
MI0000108
ID
hsa-mir-103-2
Species
Homo sapiens
Description
Homo sapiens miR-103-2 stem-loop
Genomic Location
20 : 3846141 - 3846218 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000336066 intron + 5
ENST00000354720 intron + 5
ENST00000316562 intron + 5
ENST00000361135 intron + 5
ENST00000361370 intron + 5
OTTHUMT00000077789 intron + 5
OTTHUMT00000077787 intron + 5
OTTHUMT00000077788 intron + 5
OTTHUMT00000077793 intron + 5
View the flanking features in the Genome Browser
Pre-miRNA length
78 nt
Comments
This sequence was localised to chromosome 20 and named mir-103-20 in reference [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-103-2 hsa-mir-103-1 hsa-mir-107 mmu-mir-103-1 mmu-mir-103-2
mmu-mir-107 rno-mir-103-2 rno-mir-103-1 rno-mir-107 gga-mir-103-2
gga-mir-107 gga-mir-103-1 dre-mir-103 dre-mir-107 ssc-mir-103
ssc-mir-107 age-mir-103 ggo-mir-103 ppa-mir-103 ppy-mir-103
ptr-mir-103 mml-mir-103 lla-mir-103 mne-mir-103 mml-mir-107
ptr-mir-107 ggo-mir-107 ppy-mir-107 lla-mir-107 mne-mir-107
ppa-mir-107 fru-mir-103 tni-mir-103 fru-mir-107 tni-mir-107
bta-mir-103-1 xtr-mir-107 xtr-mir-103-1 xtr-mir-103-2 bta-mir-107
mdo-mir-103-1 mdo-mir-103-2 mdo-mir-107 bta-mir-103-2
The mature miRNA of MI0000108
Mature name
hsa-miR-103
Mature sequence
48| 5'- AGCAGCAUUGUACAGGGCUAUGA -3' |70
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-103, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-103, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000353409 (targeted by hsa-miR-103, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 771633 0937119471