keyword in microRNA or target gene :
The pre-miRNA of MI0000107
Gene
EMBL AF480543
MIR
RFAM mir-29
HGNC MIRN29B2
Accession no
MI0000107
ID
hsa-mir-29b-2
Species
Homo sapiens
Description
Homo sapiens miR-29b-2 stem-loop
Genomic Location
1 : 206042411 - 206042491 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
81 nt
Comments
This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency. This miRNA maps to human chromosome 1.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-29a hsa-mir-29b-1 hsa-mir-29b-2 mmu-mir-29b-1 dme-mir-285
mmu-mir-29a mmu-mir-29c mmu-mir-29b-2 hsa-mir-29c rno-mir-29b-2
rno-mir-29a rno-mir-29b-1 rno-mir-29c gga-mir-29a gga-mir-29b-1
gga-mir-29c gga-mir-29b-2 dps-mir-285 dre-mir-29b-1 dre-mir-29b-2
dre-mir-29b-3 dre-mir-29a-1 ssc-mir-29b ssc-mir-29c ggo-mir-29a
age-mir-29a ppa-mir-29a ppy-mir-29a ptr-mir-29a mml-mir-29a
sla-mir-29a lla-mir-29a mne-mir-29a ppy-mir-29b-1 ptr-mir-29b-1
ggo-mir-29b-1 lla-mir-29b age-mir-29b ppa-mir-29b-1 ptr-mir-29b-2
ggo-mir-29b-2 ppy-mir-29b-2 sla-mir-29b mne-mir-29b ppa-mir-29b-2
fru-mir-29a-1 tni-mir-29a-1 dre-mir-29a-2 fru-mir-29b-2 tni-mir-29b-2
fru-mir-29a-2 tni-mir-29a-2 fru-mir-29b-1 tni-mir-29b-1 bta-mir-29a
xtr-mir-29d xtr-mir-29b xtr-mir-29a xtr-mir-29c bta-mir-29b
bta-mir-29c mdo-mir-29b mdo-mir-29a
The mature miRNA of MI0000107
Mature name
hsa-miR-29b
Mature sequence
52| 5'- UAGCACCAUUUGAAAUCAGUGUU -3' |74
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000321423 (targeted by hsa-miR-29b, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000344606 (targeted by hsa-miR-29b, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000377565 (targeted by hsa-miR-29b, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 523654 0937119471