keyword in microRNA or target gene :
The pre-miRNA of MI0000102
Gene
EMBL AF480538
EMBL AF480498
RFAM mir-10
HGNC MIRN100
Accession no
MI0000102
ID
hsa-mir-100
Species
Homo sapiens
Description
Homo sapiens miR-100 stem-loop
Genomic Location
11 : 121528147 - 121528226 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
80 nt
Comments
This sequence is localised to chromosome 11 and was named mir-100-11 in reference [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-99a hsa-mir-100 mmu-mir-99a mmu-mir-99b dme-mir-100
mmu-mir-100 hsa-mir-99b rno-mir-99a rno-mir-99b rno-mir-100
gga-mir-99a gga-mir-100 dps-mir-100 aga-mir-100 dre-mir-99-1
dre-mir-99-2 dre-mir-100-1 dre-mir-100-2 mml-mir-99a ptr-mir-99a
ggo-mir-99a ppy-mir-99a lla-mir-99a mne-mir-99a ppa-mir-99a
ggo-mir-100 age-mir-100 ppa-mir-100 ppy-mir-100 ptr-mir-100
mml-mir-100 sla-mir-100 lla-mir-100 fru-mir-100 tni-mir-100
bta-mir-99a xtr-mir-99 xtr-mir-100 mdo-mir-100 bta-mir-99b
ame-mir-100
The mature miRNA of MI0000102
Mature name
hsa-miR-100
Mature sequence
13| 5'- AACCCGUAGAUCCGAACUUGUG -3' |34
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000240185 (targeted by hsa-miR-100, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
ENST00000371750 (targeted by hsa-miR-100, predicted by TargetScan)
Uncharacterized protein C1orf34 (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q6PIU8]
 
     
ENST00000262675 (targeted by hsa-miR-100, predicted by TargetScan)
Uncharacterized protein C1orf34 (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q6PIU8]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 38373 0937119471