keyword in microRNA or target gene :
The pre-miRNA of MI0000097
Gene
EMBL AF480567
EMBL AF480533
HGNC MIRN95
Accession no
MI0000097
ID
hsa-mir-95
Species
Homo sapiens
Description
Homo sapiens miR-95 stem-loop
Genomic Location
4 : 8057928 - 8058008 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000361581 intron + 14
ENST00000361737 intron + 14
ENST00000318888 intron + 10
ENST00000341937 intron + 15
ENST00000296372 intron + 16
View the flanking features in the Genome Browser
Pre-miRNA length
81 nt
Comments
This sequence is localised to chromosome 4 and was named mir-95-4 in reference [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-95 rno-mir-421 ssc-mir-95 ptr-mir-95 ggo-mir-95
ppy-mir-95 sla-mir-95 lla-mir-95 ppa-mir-95 hsa-mir-545
hsa-mir-421 bta-mir-545
The mature miRNA of MI0000097
Mature name
hsa-miR-95
Mature sequence
49| 5'- UUCAACGGGUAUUUAUUGAGCA -3' |70
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000375226 (targeted by hsa-miR-95, predicted by TargetScan)
retinoblastoma-associated factor 600 [Source:RefSeq_peptide;Acc:NP_065816]
 
     
ENST00000251245 (targeted by hsa-miR-95, predicted by TargetScan)
AT-rich interactive domain-containing protein 1A (ARID domain- containing protein 1A) (SWI/SNF-related, matrix-associated, actin- dependent regulator of chromatin subfamily F member 1) (SWI-SNF complex protein p270) (B120) (SWI-like protein) (Osa homolog [Source:Uniprot/SWISSPROT;Acc:O14497]
 
     
ENST00000294383 (targeted by hsa-miR-95, predicted by TargetScan)
Ubiquitin carboxyl-terminal hydrolase 24 (EC 3.1.2.15) (Ubiquitin thioesterase 24) (Ubiquitin-specific-processing protease 24) (Deubiquitinating enzyme 24). [Source:Uniprot/SWISSPROT;Acc:Q9UPU5]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 374296 0937119471