keyword in microRNA or target gene :
The pre-miRNA of MI0000089
Gene
EMBL AJ421753
HGNC MIRN31
Accession no
MI0000089
ID
hsa-mir-31
Species
Homo sapiens
Description
Homo sapiens miR-31 stem-loop
Genomic Location
9 : 21502114 - 21502184 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
71 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-31 dme-mir-31b dme-mir-31a mmu-mir-31 rno-mir-31
gga-mir-31 dps-mir-31a dps-mir-31b mml-mir-31 ptr-mir-31
ggo-mir-31 ppy-mir-31 mne-mir-31 ppa-mir-31 dre-mir-31
bta-mir-31 xtr-mir-31 sme-mir-31b mdo-mir-31 bmo-mir-31
ame-mir-31a
The mature miRNA of MI0000089
Mature name
hsa-miR-31
Mature sequence
9| 5'- GGCAAGAUGCUGGCAUAGCUG -3' |29
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377083 (targeted by hsa-miR-31, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000375226 (targeted by hsa-miR-31, predicted by TargetScan)
retinoblastoma-associated factor 600 [Source:RefSeq_peptide;Acc:NP_065816]
 
     
ENST00000374937 (targeted by hsa-miR-31, predicted by TargetScan)
Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII). [Source:Uniprot/SWISSPROT;Acc:O43432]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 564948 0937119471