keyword in microRNA or target gene :
The pre-miRNA of MI0000087
Gene
EMBL AJ421751
RFAM mir-29
HGNC MIRN29A
Accession no
MI0000087
ID
hsa-mir-29a
Species
Homo sapiens
Description
Homo sapiens miR-29a stem-loop
Genomic Location
7 : 130212046 - 130212109 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
64 nt
Comments
miR-29a was previously know as miR-29 here and in [1]. This sequence maps to human chromosome 7.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-29a hsa-mir-29b-1 hsa-mir-29b-2 mmu-mir-29b-1 dme-mir-285
mmu-mir-29a mmu-mir-29c mmu-mir-29b-2 hsa-mir-29c rno-mir-29b-2
rno-mir-29a rno-mir-29b-1 rno-mir-29c gga-mir-29a gga-mir-29b-1
gga-mir-29c gga-mir-29b-2 dps-mir-285 dre-mir-29b-1 dre-mir-29b-2
dre-mir-29b-3 dre-mir-29a-1 ssc-mir-29b ssc-mir-29c ggo-mir-29a
age-mir-29a ppa-mir-29a ppy-mir-29a ptr-mir-29a mml-mir-29a
sla-mir-29a lla-mir-29a mne-mir-29a ppy-mir-29b-1 ptr-mir-29b-1
ggo-mir-29b-1 lla-mir-29b age-mir-29b ppa-mir-29b-1 ptr-mir-29b-2
ggo-mir-29b-2 ppy-mir-29b-2 sla-mir-29b mne-mir-29b ppa-mir-29b-2
fru-mir-29a-1 tni-mir-29a-1 dre-mir-29a-2 fru-mir-29b-2 tni-mir-29b-2
fru-mir-29a-2 tni-mir-29a-2 fru-mir-29b-1 tni-mir-29b-1 bta-mir-29a
xtr-mir-29d xtr-mir-29b xtr-mir-29a xtr-mir-29c bta-mir-29b
bta-mir-29c mdo-mir-29b mdo-mir-29a
The mature miRNA of MI0000087
Mature name
hsa-miR-29a
Mature sequence
42| 5'- UAGCACCAUCUGAAAUCGGUU -3' |62
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000321423 (targeted by hsa-miR-29a, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000344606 (targeted by hsa-miR-29a, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000377565 (targeted by hsa-miR-29a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
3. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
4. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
5. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 788137 0937119471